Journal: iScience

Article Title: Migration of human T cells can be differentially directed by electric fields depending on the extracellular microenvironment

doi: 10.1016/j.isci.2024.109746

Figure Lengend Snippet:

Article Snippet: Mouse IgG2a isotype control - FITC , Miltenyi Biotec , Cat#: 130-113-271 Lot: 5200908299.

Techniques: Recombinant, Control, Cell Isolation, Isolation, Software

Journal: Breast cancer research and treatment

Article Title: Viral transduction of the HER2-extracellular domain expands trastuzumab-based photoimmunotherapy for HER2-negative breast cancer cells.

doi: 10.1007/s10549-015-3265-y

Figure Lengend Snippet: Fig. 1 HER2-extracellular domain (ECD) expression induced by Ad- HER2-ECD. a Western blot analysis showing expression of the 100-kDa HER2-ECD protein in Ad-HER2-ECD-infected cells but not in Ad-GFP-infected or parental cells. Actin was used as a loading control. b Flowcytometric analysis showing HER2-ECD expression on the cell membrane. Cells were labeled with APC-conjugated

Article Snippet: In experiments with replication-deficient adenoviral vector, cells were infected with Ad-HER2-ECD or Ad-GFP at a multiplicity of infection (MOI) of 50 for 48 h. Flowcytometric analysis To measure the expression of HER2-ECD in cells infected with Ad-HER2-ECD, cells were labeled with APC-conjugated mouse monoclonal anti-HER2-ECD antibody (R&D Systems Inc.) or APC-conjugated IgG2b as control (Miltenyi Biotec, Inc.) on ice for 45 min and were then analyzed using a FACS instrument (BD Biosciences).

Techniques: Expressing, Western Blot, Infection, Control, Membrane, Labeling

Journal: Breast cancer research and treatment

Article Title: Viral transduction of the HER2-extracellular domain expands trastuzumab-based photoimmunotherapy for HER2-negative breast cancer cells.

doi: 10.1007/s10549-015-3265-y

Figure Lengend Snippet: Fig. 2 Trastzumab-IR700 binds to the transduced cell surface HER2- ECD Immunofluorescent analysis of Trastzumab-IR700 (Tra-IR700) binding to HER2-ECD-transduced by Ad-HER2-ECD on the cell surface of breast cancer cells. Scale bars 50 lm

Article Snippet: In experiments with replication-deficient adenoviral vector, cells were infected with Ad-HER2-ECD or Ad-GFP at a multiplicity of infection (MOI) of 50 for 48 h. Flowcytometric analysis To measure the expression of HER2-ECD in cells infected with Ad-HER2-ECD, cells were labeled with APC-conjugated mouse monoclonal anti-HER2-ECD antibody (R&D Systems Inc.) or APC-conjugated IgG2b as control (Miltenyi Biotec, Inc.) on ice for 45 min and were then analyzed using a FACS instrument (BD Biosciences).

Techniques: Binding Assay

Journal: Breast cancer research and treatment

Article Title: Viral transduction of the HER2-extracellular domain expands trastuzumab-based photoimmunotherapy for HER2-negative breast cancer cells.

doi: 10.1007/s10549-015-3265-y

Figure Lengend Snippet: Fig. 3 Microscopic analysis of the effect of Tra-IR700-mediated PIT on the cell morphology and cell death of HER2-ECD-transduced HER2-negative cells. a Phase contrast analysis of the morphology of the breast cancer cells MCF-7 and MDA-MB-231 immediately following PIT using 0, 6, or 18 J. Scale bars 50 lm. b Phase contrast analysis of control, Ad-GFP-infected or Ad-HER2-ECD-infected MCF-7 and MDA-MB-231 cells before and after 72 h treatment with

Article Snippet: In experiments with replication-deficient adenoviral vector, cells were infected with Ad-HER2-ECD or Ad-GFP at a multiplicity of infection (MOI) of 50 for 48 h. Flowcytometric analysis To measure the expression of HER2-ECD in cells infected with Ad-HER2-ECD, cells were labeled with APC-conjugated mouse monoclonal anti-HER2-ECD antibody (R&D Systems Inc.) or APC-conjugated IgG2b as control (Miltenyi Biotec, Inc.) on ice for 45 min and were then analyzed using a FACS instrument (BD Biosciences).

Techniques: Control, Infection

Journal: Breast cancer research and treatment

Article Title: Viral transduction of the HER2-extracellular domain expands trastuzumab-based photoimmunotherapy for HER2-negative breast cancer cells.

doi: 10.1007/s10549-015-3265-y

Figure Lengend Snippet: Fig. 4 Effect of Tra-IR700 mediated PIT treatment of HER2-ECD transduced HER2-negative cells on cell viability. Tra-IR700-medi- ated PIT was applied to the indicated cells along with seven control conditions and cell viability was quantified 72 h after PIT (24 J for MDA-MB-231 and 36 J for MCF-7) using the XTT assay. Only the

Article Snippet: In experiments with replication-deficient adenoviral vector, cells were infected with Ad-HER2-ECD or Ad-GFP at a multiplicity of infection (MOI) of 50 for 48 h. Flowcytometric analysis To measure the expression of HER2-ECD in cells infected with Ad-HER2-ECD, cells were labeled with APC-conjugated mouse monoclonal anti-HER2-ECD antibody (R&D Systems Inc.) or APC-conjugated IgG2b as control (Miltenyi Biotec, Inc.) on ice for 45 min and were then analyzed using a FACS instrument (BD Biosciences).

Techniques: Control, XTT Assay

Journal: Innate immunity

Article Title: Identification of CD300a as a new hypoxia-inducible gene and a regulator of CCL20 and VEGF production by human monocytes and macrophages.

doi: 10.1177/1753425913507095

Figure Lengend Snippet: Figure 6. Differential modulation of CCL20 and VEGF production by CD300a cross-linking on primary Mn. Mn were seeded onto plates precoated with a specific anti-CD300a agonist mAb (+) or a control IgG1 (–) and goat anti-mouse IgG-F(ab0)2, and cultured for 24 h under hypoxic conditions (Hypo, +) or in the presence of DFX (+). Cells were harvested and analyzed for (A) CCL20 and (C) VEGF mRNA expression by qRT-PCR. Relative transcript expression was calculated as detailed in the legend to Figure 1B. Data shown are expressed as fold increase relative to control Ig-cross-linked cells (considered equal to 1) and are representative of one of three experiments performed. (B) CCL20 and (D) VEGF content in conditioned medium were assayed by ELISA. Results are expressed as pg/106 cells/ml and represent the mean SEM of three different experiments. Values significantly different from those of cells cross- linked with isotype-matched Ab according to the Student’s t-test: *P 0.05; **P 0.01.

Article Snippet: Flow cytometry was performed as described.38 For the detection of surface markers, cells were re-suspended with FACS buffer (PBS supplemented with 0.2% BSA, 0.01% NaN3) and incubated with the fluorochrome-conjugated mAbs, anti-CD14-PE and antiCD300a (IRp60, clone P192 produced as described in Cantoni et al.14), the isotype-matched control Abs, mouse IgG2a-PE (Biolegend, Campoverde, Milano, Italy) and mouse IgG2a (R&D Systems, Space Import Export, Milano, Italy), and the secondary FITC-conjugated goat anti-mouse Ab (Invitrogen Life Technologies, Monza, Italy) for 30min at 4 C, after blocking nonspecific sites with rabbit IgG (Sigma, Milano, Italy).

Techniques: Control, Cell Culture, Expressing, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay

Journal: Innate immunity

Article Title: Identification of CD300a as a new hypoxia-inducible gene and a regulator of CCL20 and VEGF production by human monocytes and macrophages.

doi: 10.1177/1753425913507095

Figure Lengend Snippet: Figure 7. CCL20 and VEGF production regulation by CD300a triggering on MDMs. MDMs were incubated with anti-CD300a Ab (+) or control isotype IgG1 (–) and goat anti-mouse IgG-F(ab0)2 for 24 h under hypoxic conditions (Hypo, +) or in the presence of DFX (+). (A) CCL20 mRNA expression, (C) VEGF mRNA expression and (B, D) cytokine release into the supernatant were analyzed 24 h after stimulation, as detailed in the legend to Figure 6. Values significantly different from those of cells cross-linked with isotype- matched Ab according to the Student’s t-test: * P 0.05.

Article Snippet: Flow cytometry was performed as described.38 For the detection of surface markers, cells were re-suspended with FACS buffer (PBS supplemented with 0.2% BSA, 0.01% NaN3) and incubated with the fluorochrome-conjugated mAbs, anti-CD14-PE and antiCD300a (IRp60, clone P192 produced as described in Cantoni et al.14), the isotype-matched control Abs, mouse IgG2a-PE (Biolegend, Campoverde, Milano, Italy) and mouse IgG2a (R&D Systems, Space Import Export, Milano, Italy), and the secondary FITC-conjugated goat anti-mouse Ab (Invitrogen Life Technologies, Monza, Italy) for 30min at 4 C, after blocking nonspecific sites with rabbit IgG (Sigma, Milano, Italy).

Techniques: Incubation, Control, Expressing

Journal:

Article Title: Glycated LDL increases monocyte CC chemokine receptor 2 expression and monocyte chemoattractant protein-1-mediated chemotaxis

doi: 10.1016/j.atherosclerosis.2007.10.035

Figure Lengend Snippet: AGE-LDL increased cell surface expression of CCR2. Macrophages were incubated in the presence of either LDL or AGE-LDL for 48 hours, and CCR2 surface expression was determined by flow cytometry with anti-CCR2 IgG and expressed as specific mean fluorescence intensity (MFI). Data are shown as mean ± SEM (n=3). The experiments were done twice for each donor.

Article Snippet: An anti-human Receptor for AGE (RAGE) mouse monoclonal antibody and its IgG2b isotype control (R&D systems) served to test the involvement of RAGE by blocking receptor-ligand interactions. table ft1 table-wrap mode="anchored" t5 caption a7 Forward Reverse CCR2 TCCATTCTCTCAGGCTTGC TGAGCATCAAGGACATCTG GAPDH TGAAGGTCGGAGTCAACGGATTTGGTCGTA ATCTCGCTCCTGGAAGATGGTGATGGGATT Open in a separate window CC chemokine receptor 2 (CCR2); glyceraldehyde 3-phosphate dehydrogenase (GAPDH) caption a8 PCR primers

Techniques: Expressing, Incubation, Flow Cytometry, Fluorescence